29 Mar 2022

Understanding DESeq2

25 3月 2022

Vultr trip

Recently I found that geph is getting less and less useful, such as frequent disconnection, or unable to connect to the main server, or complaining about too many logins. Seriously, the experience was terrible. Once upon a time, I was also a person who surfed the sea of the Internet. Now, starting to miss the days of shadowsocks.

One or two, I decided to start using shadowsocks again.

Buy vps

First, I shoud to buy a virtual machine which can run a linux system and host a shadowsocks service. There is no doublt, I choose vultr.

Check server’s port is OK

To be honest, thank my little brother Michael Pacman so much for helping me to figure out the port issue.

# install nc on server and client site
sudo pacman -S openbsd-netcat

# server: open port <port> on server
sudo nc -lv -p <port>

# client: check whether the client network can access it
nc -nv <server_ip_v4> <port>
<input something>

# If we can see <input something> from server, that means the network of server is accessible.
# If not, change port or contact the staff of vultr to know your server better.

Ok, port is not OK

That was true. I meet it. So, two thousand years later.

# Change game rule
sudo iptables -A INPUT -p tcp --dport <ss_port> -j ACCEPT
sudo iptables -A INPUT -p udp --dport <ss_port> -j ACCEPT
sudo iptables -A INPUT -p tcp --dport <ssh_port> -j ACCEPT

# Save it
sudo iptables-save -f /etc/iptables/iptables.rules

# Run systemd iptables service
sudo systemctl start iptables.service
sudo systemctl status iptables.service

# OK
sudo systemctl enable iptables.service

For details, you can refer the documentation here. Just like vultr’s staff saied, We do not recommend disabling your firewall.

Configure shadowsocks

pacman -S shadowsocks-rust-opt
pacman -S shadowsocks-v2ray-plugin

# client configuration
cat /etc/shadowsocks-rust/config.json
{
    "server": "<server_ip>",
    "server_port": <ss_port>,
    "local_address": "127.0.0.1",
    "local_port": 1080,
    "password": "<passwd>",
    "timeout": 600,
    "method": "chacha20-ietf-poly1305",
    "plugin": "v2ray-plugin",
}

# server configuration
cat /etc/shadowsocks-rust/config.json
{
    "server": "::",
    "server_port": <ss_port>,
    "password": "<passwd>",
    "timeout": 600,
    "method": "chacha20-ietf-poly1305",
    "plugin": "v2ray-plugin",
    "plugin_opts": "server"
}

# on client and server, keep time
sudo timedatectl set-ntp true
sudo hwclock --systohc

# server
systemctl start shadowsocks-rust-server@config.service

# client
systemctl start shadowsocks-rust@config.service

# OK
systemctl enable shadowsocks-rust-server@config.service
systemctl enable shadowsocks-rust@config.service

Thank my little brother Michael Pacman again for helping me figure the fault of server configuration. We should use :: for server address, not 127.0.0.1 for server address.

Hope for a free web.

07 3月 2022

Rosalind DNA

Problem

A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains. An example of a length 21 DNA string (whose alphabet contains the symbols ’A’, ’C’, ’G’, and ’T’) is “ATGCTTCAGAAAGGTCTTACG.” Given: A DNA string s of length at most 1000 nt. Return: Four integers (separated by spaces) counting the respective number of times that the symbols ’A’, ’C’, ’G’, and ’T’ occur in s.

Sample Dataset

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample Output

20 12 17 21

Attempts

Rust

use std::env;
use std::fs::File;
use std::io::prelude::*;

fn count_nucleotides(dna: String) -> [u64; 5] {
    let mut counts: [u64; 5] = [0; 5];
    for nucleotide in dna.chars() {
        match nucleotide {
            'A' => counts[0] += 1,
            'C' => counts[1] += 1,
            'G' => counts[2] += 1,
            'T' => counts[3] += 1,
            _ => counts[4] += 1,
        }
    }
    counts
}

fn main() {
    let args: Vec<String> = env::args().collect();
    let filename = &args[1];
    let mut f = File::open(filename).expect("file not found");
    let mut dna = String::new();
    f.read_to_string(&mut dna).expect("unable to read file");

    let counts: [u64; 5] = count_nucleotides(dna);

    println!("A: {}", counts[0]);
    println!("C: {}", counts[1]);
    println!("G: {}", counts[2]);
    println!("T: {}", counts[3]);
    println!("Other: {}", counts[4]);
}

10 Sep 2020

Concurrent

Today, I learn python concurrent from python3 cookbook.

Bellow is some exampels using concurrent.

submit

import concurrent.futures

# Some function
do = [[1, 2, 3], [4, 5, 6]]

def work(x):
    print(f"x: {x}")
    return x

with concurrent.futures.ProcessPoolExecutor() as pool:
    # Example of submitting work to the pool
    future_result = pool.submit(work, do)

    # Obtaining the result (blocks until done)
    r = future_result.result()
    print(f"r: {r}")

x: [[1, 2, 3], [4, 5, 6]]
r: [[1, 2, 3], [4, 5, 6]]

map

with concurrent.futures.ProcessPoolExecutor() as pool:
    # Example of submitting work to the pool
    future_result = []
    for i in pool.map(work, do):
        future_result.append(i)

    # Obtaining the result (blocks until done)
    print(f"r: {future_result}")

x: [1, 2, 3]
x: [4, 5, 6]
r: [[1, 2, 3], [4, 5, 6]]

07 Sep 2020

Algorithm

Course

Algorithm Toolbox